Guidelines from the American Association for Molecular Pathology address the choice and development of appropriate diagnostic assays, quality control and validation and implementation of molecular diagnostic tests.⁴ In the UK, a national external quality assessment scheme has been approved for the molecular genetics of thrombophilia and pilot studies are currently in progress for the molecular diagnosis of haematological malignancies and for haemophilia A. It is true, however, that the development and implementation of quality control methods and assurance standards still lag behind the rapid rate of expansion of molecular techniques.^5,⁶ To overcome this, both at national and international level, several groups are attempting to reach a standardization of molecular methodologies applied to fusion gene quantification (BCR–ABL1, PML–RARA, etc.) in myeloid malignancies as well as the molecular monitoring of residual disease using antigen receptor targets in acute and chronic lymphoid malignancies.

In this chapter, some of the applications of the PCR in a diagnostic haematology laboratory are described. For the reasons just mentioned, the analysis of PCR products has largely superseded other techniques, including Southern blot analysis, and capillary electrophoresis has replaced polyacrylamide gel electrophoresis. For situations in which these are still appropriate, the reader is referred to previous editions of this book.

Extraction of DNA

DNA can be extracted from blood, bone marrow or tissue samples. The quality and quantity of the DNA obtained will vary depending on the size, age and cell count of the sample. As a rule, 5–10 ml of blood in ethylenediaminetetra-acetic acid (EDTA) will suffice. The DNA is extracted from all nucleated cells and is called genomic DNA.

In the nucleus, the DNA is tightly associated with many different proteins as chromatin. It is important to remove these as well as other cellular proteins to extract the DNA. This is achieved through the use of organic solvents, salt precipitation or DNA-affinity columns. An aqueous solution of DNA is obtained, from which the DNA is further purified by precipitation. A number of DNA extraction kits have been developed. They are commercially available and cost-effective. In addition, equipment that can achieve simultaneous extraction from a large number of samples is available and will be discussed below. These can significantly reduce the amount of time required for DNA extraction, bypass the use of organic solvents and provide good quality control of the reagents used.

DNA Extraction Kits

We are currently using two different types of DNA extraction kit, depending essentially on the quantity of DNA required. The first (The QIAamp system, Qiagen, Crawley, West Sussex) is a robust method for obtaining ≈5 μg of DNA from 200 μl of whole blood. This method revolves around a high-affinity DNA binding matrix in a spin column, which can be used in a microcentrifuge or in an automated set-up. The DNA obtained is usually of high quality and sufficient for most routine analysis.

When larger amounts of DNA are required, perhaps for storage and more extensive analysis of important samples, we use from 3 to 10 ml blood in the Gentra Puregene Blood kit (Qiagen), which can yield upwards of 100 μg of DNA. This method depends on salting-out of proteins after sequential red cell and then white cell lysis, followed by isopropanol precipitation of the DNA.

Protocols are of course supplied with any kit method and will therefore not be given in detail here. For preparation of reagents, and a protocol for the manual extraction of DNA from blood using organic solvents, the reader is referred to previous editions of this book.

Polymerase chain reaction

Development of the PCR ³ has had a dramatic impact on the study and analysis of nucleic acids. Through the use of a thermostable DNA polymerase, Taq polymerase (available from various suppliers, including Applied Biosystems, Warrington and Thermo-Fisher, Runcorn) extracted from the bacterium Thermus aquaticus, the PCR results in the amplification of a specific DNA fragment such that it can be visualized using intercalating SYBR Safe (Invitrogen, Paisley) added to agarose gels. Ethidium bromide, a carcinogenic product, is no longer in use for safety reasons. The procedure takes only a few hours and requires only a very small amount of starting material.

Principle

A DNA polymerase will synthesize the complementary strand of a DNA template in vitro. A stretch of double-stranded DNA is required for the synthesis to be initiated. This double-stranded sequence can be generated by annealing an oligonucleotide (oligo), which is a short, single-stranded DNA molecule usually between 17 and 22 bases in length, to a single-stranded DNA template. These oligos, which are synthesized in vitro, will prime the DNA synthesis and are therefore referred to as primers.

In the PCR, at least two oligos are used. One primes the synthesis of DNA in the forward direction or along the coding strand of the DNA, whereas the other primes DNA synthesis in the reverse direction or along the non-coding strand. The other components of the reaction are the DNA template from which the DNA fragment will be amplified, the four deoxynucleotide triphosphates (dATP, dTTP, dCTP and dGTP) required as the building blocks of the newly synthesized DNA, a salt buffer containing MgCl₂ and the thermostable DNA polymerase (Taq polymerase).

The first step of the reaction is to denature the DNA, generating single-stranded templates, by heating the reaction mixture to 95°C. The reaction is then cooled to a temperature, usually between 50°C and 68°C, that permits the annealing of the primers to the DNA template but only at their specific complementary sequences. The temperature is then raised to 72°C, at which temperature the Taq polymerase efficiently synthesizes DNA, extending from the primers in a 5′ to 3′ direction. Cyclical repetition of the denaturing, annealing and extension steps, by simply changing the temperature of the reaction in an automated heating block, results in exponential amplification of the DNA that lies between the two primers (Fig. 8.1).

Figure 8.1 The polymerase chain reaction. Cyclical repetition of three temperatures for denaturing, annealing and extending DNA, respectively, gives rise to an exponential amplification of a DNA fragment between two primer sequences directing DNA synthesis on opposite strands of the DNA template.

The specificity of the DNA fragment that is amplified is therefore determined by the sequences of the primers used. A sequence of 17–22 base pairs (bp) is statistically likely to be unique in the human genome and so primers of this length and longer will anneal at only one specific place on a template of genomic DNA. One general requirement of the PCR therefore is some knowledge of the DNA sequence of the gene that is to be amplified. The relative positioning of the two primers is another important consideration. They must anneal to complementary strands and must prime DNA synthesis in opposite directions pointing towards one another. There is also an upper limit to the distance apart that the oligos can be placed; fragments of several kilobase pairs (kb) in length can be amplified, but the process is most efficient for fragments of several hundred bp.

Reagents

Taq polymerase and oligonucleotide primers. These can be purchased from a variety of different companies, such as Applied Biosystems (Warrington), Thermo-Fisher (Runcorn) and Sigma-Genosys (Poole). The oligos are usually 17–22 bases in length.

PCR buffers. These are usually supplied with the Taq polymerase. Three different buffers can be prepared as follows:

×10 PCR buffer I: 100 mmol/l Tris-HCl, pH 8.3, 500 mmol/l KCl, 15 mmol/l MgCl₂, 0.1% (w/v) gelatin, 0.5% (v/v) NP40 and 0.5% (v/v) Tween 20

×10 PCR buffer II: 670 mmol/l Tris, pH 8.8, 166 mmol/l (NH₄)₂SO₄, 25 mmol/l MgCl₂, 670 μmol/l Na₂EDTA, 1.6 mg/ml bovine serum albumin (BSA) and 100 mmol/l β-mercaptoethanol. This buffer is used in conjunction with 10% dimethyl sulphoxide (DMSO) in the final reaction mixture

×10 PCR buffer III: 750 mmol/l Tris, pH 8.8, 200 mmol/l (NH₄)₂SO₄, 0.1% (v/v) Tween 20. A solution of 25 mmol/l MgCl₂ is also prepared and added separately to the PCR reaction.

dNTP, 10 mmol/l. Take 10 μl of 100 mmol/l dATP, 10 μl of 100 mmol/l dTTP, 10 μl of 100 mmol/l dCTP, 10 μl of 100 mmol/l dGTP and 60 μl of water to make a 100 μl of 10 mmol/l dNTP.

DMSO

Agarose, Type II medium electroendosmosis. ×10 Tris-borate-EDTA (TBE) buffer. Add 216 g of Trizma base, 18.6 g of EDTA and 110 g of orthoboric acid to 1600 ml water. Dissolve and top up to 21; dilute 1 in 20 for use as ×0.5 TBE buffer.

SYBR Safe DNA Stain, Invitrogen, Cat no S33102 (×10 000 concentrated). Add 5 μl every 50 ml of agarose gel preparation.

Tracking dye. Weigh 15 g of Ficoll (type 400), 0.25 g of bromophenol blue and 0.25 g of xylene cyanol. Make up to 100 ml with water, cover and mix by inversion; it will take a considerable amount of mixing to get the solution homogeneous. Dispense into aliquots.

Method

Optimal conditions for the reaction have to be derived empirically, with the magnesium concentration and annealing temperature being the most important parameters.⁷ The choice of buffer depends on the enzyme being used and the company will usually supply the most appropriate one. For genes with a high GC content, buffer II in combination with 10% DMSO may give better amplification. In most cases, a 25 μl reaction volume suffices. A blank control should always be included (i.e. a reaction without any template) to control for contamination. If the blank control yields a product, the analysis is invalid. A DNA sample that is known to amplify can also be included and this sample may then be used as a normal or positive control.

The risk of contamination cannot be overemphasized. It can be minimized by using plugged tips and having dedicated micropipettes and areas for each step of the analysis. The optimum cycling conditions need to be determined for each thermocycler. Specificity is often improved by ‘hot start’ PCR. This is achieved by setting up all the PCR tests on wet ice and transferring the tubes to the thermocycler once it reaches 95°C or by using an enzyme that only becomes activated when heated at 95°C for several minutes. In preparing a group of reactions, a premix solution is prepared that can be dispensed into microcentrifuge tubes, tube strips or PCR reaction 96-well plates to which the template DNA is added. When a particular PCR is to be performed repetitively over a period of time, it is helpful to prepare a large volume (e.g. 10 ml) of the reaction mixture (without DNA or Taq polymerase), aliquot it and store it at –20°C.

1. Prepare a PCR mixture for 20 reactions (with a final volume of 25 μl for each DNA sample) as follows:

Stock solution	Volume (μl)	Final concentration
×10 PCR buffer III	50	×1
25 mmol/l MgCl₂	40	2.0 mmol/l
10 mmol/l dNTP	10	0.02 mmol/l
10 μmol/l Primer (1)	20	0.04 μmol/l
10 μmol/l Primer (2)	20	0.04 μmol/l
5 u/μl Taq polymerase	2	0.02 μ/ml
Water	358
Final volume	500

Add the Taq polymerase last, mix well and pulse-spin in a microcentrifuge to bring down the contents of the tube.

2. Aliquot 24 μl of the PCR reaction mix into each tube. Add 1 μl of template DNA at approximately 0.05 mg/ml into all except one of the reaction tubes.

3. Place the tubes in a PCR machine, using a heated lid, programmed for the following conditions: an initial step of 5 min at 95°C and then 30 cycles of 95°C for 45 s, 58°C for 45 s and 72°C for 1 min in sequence, followed by a final extension step at 72°C for 10 min. These conditions are suitable for many primer pairs, although some will require different annealing temperatures or longer extension times.

4. While the PCR program is running, a 1.5% agarose mini-gel is prepared: add 0.75 g of agarose to 50 ml of ×0.5 TBE buffer and heat until completely dissolved. Add 2 μl of SYBR Safe, allow the agarose to cool slightly and pour with the appropriate comb in position.

5. To check if the amplification has been successful, add 1 μl of tracking dye to a 10 μl aliquot of the PCR reaction mixture, being careful not to pipette the mineral oil overlaying the PCR reaction.

6. Load the gel and run at a constant voltage of 100 V for 1 h in ×0.5 TBE buffer. A molecular size marker should be included to establish the size of the amplified fragment; these are commercially available (e.g. HyperLadder from Bioline, London). The marker used in this chapter is the plasmid pEMBL 8 digested with Taq I and Pvu II to yield fragments of 1443, 1008, 613, 357, 278, 193 and 108 bp.

7. Visualize the DNA on an ultraviolet (UV) transilluminator and take a photograph.

Modifications and Developments

The procedure described earlier is a guideline for setting up and checking a standard PCR amplification. As the test dictates, modifications can be used, such as the following:

Radiolabelling. A PCR can be labelled with ³²P by adding 0.1 μl of [α³²P]dCTP per tube to the reaction mixture.

Multiplex. More than one fragment can be amplified in the same tube simply by adding further primer pairs. It is important that the different pairs all work equally well under the same conditions.

Nested PCR. This involves successive rounds of amplification using two pairs of primers; the second pair, located within the sequence amplified by the first, allows products to be generated from as little as a single cell.

Long-range amplification. Fragments upward of 10 kb can now be generated by PCR using modified polymerases.

Automation. High-throughput PCR amplification is being achieved through the use of robots and 96-well plate technology.

Automated fragment analysis. The method of gel electrophoresis is modified for the detection of fluorescentlylabelled PCR products on DNA fragment analysers (e.g. the ABI 3700 DNA analyser).

Problems and Interpretation

If the amplification has been successful, a discrete fragment of the expected size is seen in an SYBR Safe-stained agarose gel in all samples, except where a blank control (in which the DNA template is replaced by water) is loaded. If a product is seen in the blank control, then one of the solutions has been contaminated. In this case, the experiment and all the working solutions must be discarded and the micropipettes must be cleaned. Cleaning micropipettes prior to the start of each experiment is highly recommended. To avoid contamination, setting up a master mix of all reagents is recommended before DNA samples are added to each tube.

Conversely, the absence of a fragment in all tracks indicates that the PCR has failed. This could occur for a number of reasons, the most obvious being the poor quality or omission of one of the essential reagents. The reaction may also fail if the magnesium concentration is too low (standard concentration 1.5 mM) or if the annealing temperature is too high. DNA quality is often one of the major reasons for failure. If one particular DNA sample repeatedly fails to amplify, then the sample should be re-extracted using Proteinase K (Sigma, Poole) and phenol and chloroform and reprecipitated in one-tenth volume of 5 mol/l ammonium acetate or 3M sodium acetate pH 4.8 and 2.5 volumes of ethanol. We have also found that for samples prepared using the Gentra method, passing the DNA through a Qiagen column substantially improves DNA quality and PCR efficiency. Another problem is the presence of non-specific fragments or just a smear of amplified product. This can occur if the magnesium concentration is too high or if the annealing temperature is too low.

Analysis of polymerase chain reaction products

Presence or Absence of a Polymerase Chain Reaction Product

Initially, PCR products are commonly and conveniently visualized by agarose gel electrophoresis. However, it has also become commonplace to visualize PCR products directly on DNA analysers – in particular the Applied Biosystems 3130xl (Warrington) – through the use of a fluorescent label on one of the primers. If appropriate primers and controls are included in an experiment, the actual presence of a product can be highly informative.

Amplification Refractory Mutation System

Principle

Point mutations and small insertions or deletions can be identified directly by the presence or absence of a PCR product using allele-specific primers.^8,⁹ Two different oligos are used that differ only at the site of the mutation (the amplification refractory mutation system or ARMS, primers) with the mismatch distinguishing the normal and mutant base located at the 3′ end of the oligo. In a PCR, an oligo with a mismatch at its 3′ end will fail to prime the extension step of the reaction. Each test sample is amplified in two separate reactions containing either a mutant ARMS primer or a normal ARMS primer. The mutant primer will prime amplification together with one common primer from DNA with this mutation but not from a normal DNA. A normal primer will do the opposite. To increase the instability of the 3′ end mismatch and so ensure the failure of the amplification, it is sometimes necessary to introduce a second nucleotide mismatch three or four bases from the 3′ end of both oligos. A second pair of unrelated primers at a distance from the ARMS primers is included in each reaction as an internal control to demonstrate that efficient amplification has occurred. This is essential because a failure of the ARMS primer to amplify is interpreted as a significant result and must not be the result of suboptimal reaction conditions.

Interpretation

In all the samples, apart from the blank control, the fragment produced by amplification with the internal control primers must be seen. If this is the case, then the presence or absence of a mutation is simply determined by the presence or absence of the expected fragment produced by amplification with the mutant ARMS primer and the common primer. The presence or absence of the normal allele is determined in the same way in the reaction that includes the normal ARMS primer. In this way, heterozygous, homozygous normal and homozygous mutant genes can be distinguished.

Gap-PCR

Large deletions can be detected by Gap-PCR. Primers located 5′ and 3′ to the breakpoints of a deletion will anneal too far apart on the normal chromosome to generate a fragment in a standard PCR. When the deletion is present, the sites at which these primers anneal will be brought together, enabling them to give rise to a product. An example of this is given for the detection of deletions in α° thalassaemia in Figure 8.4 on p. 149.

Figure 8.4 Detection of α° thalassaemia by multiplex Gap-PCR. The sequences of the primers used are shown in Table 8.1. A normal fragment of 1010 bp is generated by the primers α/SEA(F) and α/(R) in all lanes (although this is very faint in lane 11). In addition, a fragment of 660 bp is generated by the primer pair α/SEA(F) and SEA(R) in lanes 1, 4 and 8 in individuals who are heterozygous for the − −^SEA deletion; a fragment of 550 bp is generated by the primer pair FIL(F) and FIL(R) in lane 9 in an individual who is heterozygous for the − −^FIL deletion; a fragment of 875 bp is generated by the primer pair MED(F) and MED(R) in lane 10 in an individual who is heterozygous for the − −^MED deletion; and a fragment of 1187 bp is generated by the primer pair 20.5(F) and 20.5(R) in lane 10 in an individual who is heterozygous for the −α^20.5 deletion.

By the same principle, the sites at which primers anneal can be brought together by chromosomal translocation, giving rise to a diagnostic product. Breakpoints may be clustered over too large a region for genomic DNA to be used in these instances. However, leukaemic translocations can also give rise to transcribed fusion genes. Primer annealing sites in different genes are then juxtaposed in a hybrid messenger RNA (mRNA) molecule and can give rise to a reverse transcription-PCR (RT-PCR) product. Examples of this are given for the analysis of minimal residual disease in chronic myelogenous leukaemia (CML) in Figure 8.8 on p. 155.

Figure 8.8 Detection of minimal residual disease in chronic myelogenous leukaemia (CML) by reverse transcriptase-polymerase chain reaction (RT-PCR). (A) Diagrammatic representation of the processed exons of the BCR and ABL1 genes together with the relative position of the B2B and C5e-primers used to co-amplify BCR in the multiplex PCR. (B) Commonly observed BCR–ABL1 derivatives, b2a2 and b3a2 which give rise to p210 BCR–ABL1 and e1a2, which gives rise to p190 BCR–ABL1. The relative positions of the primers used to amplify the chimeric transcripts by multiplex PCR are shown. (C) A 2.0% agarose gel containing SYBR Safe dye through which amplicons generated by multiplex PCR using complementary DNA (cDNA) from five patients (lanes 1 to 5) were electrophoresed. The co-amplified normal BCR fragment, 808 bp in length, is seen in all samples except for the lanes containing the blank controls (B). The diagnostic sample from a patient with suspected CML, in lane 2, revealed a fragment corresponding to the b3a2 BCR–ABL1 transcript, 385 bp in length, in addition to the BCR amplicon. BCR–ABL1 is not detectable in lanes 1, 3, 4 and 5 containing follow-up samples from patients following stem cell transplantation (SCT). (D) The cDNA of these individuals was subjected to nested PCR to exclude residual disease. This reveals BCR–ABL1 transcripts, b3a2 (385 bp) and b2a2 (310 bp) in lanes 1 and 4, previously undetectable by the less sensitive multiplex PCR. However, BCR–ABL1 is not detectable in lanes 3 and 5, implying these samples are from patients in molecular remission post-SCT. B, blank controls; K (K562-b3a2) and BV (BV173-b2a2), positive controls; M, molecular size marker.

Size of the PCR Product

Principle

Deletions and insertions can be identified using agarose gel electrophoresis, when the size of the PCR product significantly differs from the size of a normal control. A higher resolution of fragment sizes is obtained by capillary electrophoresis. This is particularly appropriate in the analysis of short tandem repeat (STR) sequences that can be highly variable in length and, therefore, useful as genetic markers of different individuals. High resolution of DNA fragments is now often performed on the capillaries of the Applied Biosystems (ABI) 3700 or 3130xl DNA analysers (Warrington). These read fluorescently labelled DNA fragments as they exit from the gel and enable single base resolution from around 50–800 bp. Several examples of these applications are given in this chapter.

Restriction Enzyme Digestion

Allele-Specific Oligonucleotide Hybridization

Principle

Under appropriate conditions, short oligonucleotide probes will hybridize to their exact complementary sequence but not to a sequence in which there is even a single base mismatch.¹⁰ A pair of oligos is therefore used to test for the presence of a point mutation: a mutant oligo complementary to the mutant sequence and a normal oligo complementary to the normal sequence, with the sequence difference placed near the centre of each oligo.

The stability of the duplex formed between the oligo and the target DNA being tested (the product of a PCR reaction) depends on the temperature, the base composition and length of the oligo and the ionic strength of the washing solution. For allele-specific oligonucleotide hybridization (ASOH) studies, an empirical formula has been derived for the dissociation temperature (Td), the temperature at which half of the duplexes are dissociated: for hybridization of oligonucleotides of 14–20 bases in length. The Td can be estimated as 2°C for each dA:dT pair plus 4°C for each dG:dC base pair. This value is used as a guideline; the exact temperature at which only perfect base pairing is maintained is usually determined by trial and error.

This methodology has been widely applied for the detection of point mutations using fluorescently labelled TaqMan probes that distinguish the two alleles. Two short allele-specific probes are used, one of which will hybridize only to the wild-type allele and one of which will hybridize only to the mutant allele. Each probe is labelled with a different fluorescent colour, which is quenched while the probe remains intact, but is released if and when the probe hybridizes to its perfectly complementary sequence during the PCR reaction, as it will then be broken up by the exonuclease activity of the Taq polymerase. An example of this analysis is the detection of the factor V Leiden mutation in Figure 8.5 on p. 150.

Figure 8.5 Allelic discrimination of factor V Leiden using the TaqMan assay system. Each spot on the graph represents one well of the plate in which one DNA template is under test. In each well we either see no signal (bottom left) – NTC; only ‘red’ signals, coming from the wild-type probe (bottom right) – homozygous wild-type; only blue signals coming from the FVL probe (top left) – homozygous FVL; or a mixture of signals to give green spots coming from both the wild-type and FVL probes (top right) – heterozygous for FVL.

Interpretation

The oligos will hybridize to their perfectly complementary DNA sequence, such that the mutant oligo gives a signal only when the mutant allele is present, with the same happening for the wild-type allele. When this is the case, the interpretation of the result is straightforward; a positive signal from a particular oligo indicates the presence of that allele in the test sample. Heterozygotes and homozygotes are distinguished by using the mutant and normal oligos in tandem. With the two fluorescent colours of the Taqman probes, the heterozygote is identified as the sum of the two fluorochromes.

Other non-radioactive probes, with detection systems involving horseradish peroxidase, have also been quite widely used in this procedure.¹¹ The technique has also been modified such that the allele-specific oligonucleotides are immobilized onto nylon membranes and the patient-specific PCR product is used as the probe–the reverse dot blot procedure.¹² This allows for several different mutations to be analysed simultaneously and has proved particularly useful in the diagnosis of β thalassaemia mutations.¹³

DNA Sequencing

Principle

The Sanger chain termination method for direct DNA sequencing has become a standard diagnostic tool. In many laboratories, this procedure has superseded targeted mutation detection as it provides a robust and relatively rapid method to identify all sequence changes that may be present in a particular DNA fragment. This approach is particularly relevant where multiple different mutations may underlie a particular disorder. This is the case for β thalassaemia, glucose-6-phosphate dehydrogenase (G6PD) deficiency and the red cell membrane disorders among others and so it is not surprising that DNA sequencing has often become the method of choice for the molecular diagnosis of these diseases.

In outline, the method revolves around the de novo synthesis of DNA strands in one direction from a PCR-derived template DNA fragment. The chain is lengthened by a thermostable DNA polymerase using deoxynucleotide triphosphates in the normal way; however, included in the reaction mixture is a small proportion of labelled dideoxynucleotide triphosphates (ddNTPs), which when incorporated will prevent any further extension of the chain. This process happens millions of times along a relatively short piece of DNA (usually up to 1000 bases), which means that chaintermination will occur many times at each position along the fragment. In the Applied Biosystems BigDye system (Warrington), each of the ddNTPs is labelled with a different fluorochrome and so the products of the sequencing reaction will consist of single-stranded DNA fragments, each differing in size by one base pair and each labelled with a different colour. These fragments can then be separated by capillary electrophoresis and the order with which the different colours exit the capillary will correspond to the sequence of the DNA template.

Method

1. Mix 5 μl of the PCR product with 2 μl of ExoSapIt (GE Healthcare, Little Chalfont) and incubate at 37°C for 45 min and then 80°C for 15 min. Cool to 4°C until ready for use.

2. Prepare 10 μl sequencing reactions by mixing 1–4 μl of the ExoSapIt-treated PCR reaction (see Note 7), 2 μl of the relevant oligonucleotide primer (diluted to 0.8 pmol/μl), 1 μl of the 5 times concentrated (5×) reaction buffer and 2 μl of the BigDye ddNTP terminator mix (both supplied with the kit), made up to 10 μl with water.

3. Run the sequencing reaction, incubating at 96°C for 10 s, 50°C for 5 s and 60°C for 4 min for 25 cycles.

4. Cool samples to 4°C. Add 2.5 μl 125 mM EDTA to each sample and mix well and then add 30 μl ice-cold ethanol and mix again (see Note 8). Incubate on ice for 10 min in a sealed MicroAmp plate.

5. Centrifuge 2000 g for 20 min to pellet the DNA. Carefully remove the seal, invert the plate onto some tissue and centrifuge the plate upside down for ≈10 s to remove all residual liquid.

6. Add 125 μl 70% ethanol and centrifuge at 2000 g for 5 min. Invert and briefly spin the plate upside down again. Place on a pre-heated 95°C block for 10 s to remove any residual ethanol.

7. Resuspend in 10 μl HiDi formamide, cover with the grey septa, heat to 95°C for 5 min, snap cool on ice and place in the DNA sequence analysis platform and run using the appropriate DNA fragment analysis protocol.

Interpretation

Reading the DNA sequence from a good trace – known as an electrophoretogram – is completely straightforward: As are called as green peaks; Ts as red; Cs as blue; and Gs as black. Free software packages, such as Chromas (at: http://chromas-lite-version.fyxm.net/), are available for viewing these traces and will call the DNA sequence in the file. Simple alignment of this sequence to the GenBank reference sequence can be performed at the National Center for Bioinformatics (NCBI) using the Blast program (at: http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome) and will identify any sequence changes. Heterozygous point mutations will be seen as double peaks, with two colours overlaid. Small heterozygous insertions or deletions (indels) are harder to decipher, as the sequence 3′ of the mutation will be a double sequence, with the normal and indel allele superimposed on one another: the extent of the indel can be defined by subtracting from the expected normal sequence.

Investigation of haemoglobinopathies

Sickle Cell Disease

The presence of a sickle cell gene can be determined by haemoglobin cellulose acetate electrophoresis or a sickling test. However, there are occasions when it is beneficial to make this diagnosis by DNA analysis (e.g. in prenatal diagnosis, which can be performed at 10 weeks of pregnancy, in distinguishing HbS/S from HbS/β° thalassaemia or in confirming the diagnosis of sickle cell anaemia in a neonate). For the type of specimens collected for prenatal diagnosis, refer to p. 330.

The sickle cell mutation in codon 6 of the β globin gene (GAG → GTG) results in the loss of a Bsu36 I (or Mst II, Sau I, OxaN I or Dde I) restriction enzyme site that is present in the normal gene. It is therefore possible to detect the mutation directly by restriction enzyme analysis of a DNA fragment generated by the PCR. A pair of primers are used to amplify exons 1 and 2 of the β globin gene and the products of the PCR are digested with Bsu36 I. The loss of a Bsu36 I site in the sickle cell gene gives rise to an abnormally large restriction fragment that is not seen in normal individuals (Fig. 8.2).

β Thalassaemia

The ethnic groups with the highest incidence of β thalassaemia are the Mediterranean populations, Asian Indians, Chinese and Africans. Although more than 100 β thalassaemia mutations are known, each of these groups has its own subset of mutations, so that as few as five different mutations may account for more than 90% of the affected individuals in a population. This makes the direct detection of β thalassaemia mutations a reasonable possibility and it has become the method of choice where it is most important: in prenatal diagnosis.^13,¹⁴

The majority of mutations causing β thalassaemia are point mutations affecting the coding sequence, splice sites or promoter of the β globin gene. Methods for their detection include either ARMS or reverse dot blot analysis, although more commonly now, they are detected by direct DNA sequence analysis. Unstable and other unusual haemoglobins may also cause disease and can also be identified by direct DNA sequence analysis. An example of such a case is shown in Figure 8.3, where a picture of moderate anaemia is seen in the heterozygote due to the highly unstable and electrophoretically silent variant, haemoglobin, Durham, NC.

Figure 8.3 Sequencing of the β globin gene reveals Hb Durham-N.C. The sequencing electrophoretogram clearly shows the heterozygous mutation (arrowed), where a C peak and a T peak are superimposed and called as N. This mutation is c344T>C causing a p.Leu115Pro substitution (traditionally named as codon 114).

(Courtesy of A. Tibepu.)

α Thalassaemia

In contrast to the β thalassaemias, the most common α thalassaemia mutations are deletions. Two categories exist: those that remove only one of the two alpha globin genes on any one chromosome (α⁺ thalassaemia) and those that remove both of the alpha genes from one chromosome (α° thalassaemia). Although PCR amplification around the alpha globin locus has proved to be rather difficult, the common deletions can now be identified by a reasonably robust Gap-PCR.¹⁵ In these reactions dimethylsulphoxide (DMSO) and betaine are added. Two different multiplex PCR reactions are set up, one for the common α⁺ thalassaemias (−α^3.7 and −α^4.2) and one for the common α° thalassaemias (− −^SEA, − −^MED, − −^FIL and −α^20.5). The fragment generated by these primers across the deletion breakpoint is different in size to a control fragment that is generated from the normal chromosome as a part of the multiplex reaction. The primers that flank the deletion breakpoint are too far apart to generate a fragment from the normal chromosome in the PCR. Only when these are brought closer together as a result of the deletion can a fragment be produced. Primer sequences used in this analysis are given in Table 8.1 and an example of their application in the detection of α thalassaemias is shown in Figure 8.4. More than 30 non-deletional forms of α thalassaemia have been described. Of these, Hb Constant Spring and the α^HphIα mutation are relatively common in South-east Asian and Mediterranean populations, respectively. These can be detected by ASOH, ARMS, restriction enzyme digestion or direct sequencing of the appropriate PCR product. Unlike the β thalassaemias, α thalassaemias are not easily diagnosed using routine haematological techniques. The diagnosis of α thalassaemias is often made following exclusion of β thalassaemia and iron deficiency. Because the vast majority of cases of α thalassaemia are of the clinically benign type (i.e. α⁺ thalassaemia), it is debatable whether molecular analysis is justified to reach a diagnosis in these individuals. However, it is important that individuals with α° thalassaemia are identified and the only definitive diagnostic test is DNA analysis. The α° thalassaemias are almost entirely restricted to at-risk ethnic groups, particularly those of South-east Asian or Mediterranean origin and so it is most efficient to target these groups specifically. The diagnosis of α° thalassaemia is particularly relevant if prenatal diagnosis is to be offered to a couple who are at risk of having a fetus with hydrops, where there is an increased risk of maternal death at delivery. Guidelines derived from the UK experience as to how and when DNA analysis should be implemented have recently been updated.¹⁶

Table 8.1 Primers used in Gap-PCR analysis of α-thalassaemia

Primer name	Sequence, 5′→3′	Concentration (μmol/l)
α°	Multiplex PCR	Clark and Thein (2004)¹⁴
20.5(F)	GGGCAAGCTGGTGGTGTTACACAGCAACTC	0.1
20.5(R)	CCACGCCCATGCCTGGCACGTTTGCTGAGG	0.1
α/SEA(F)	CTCTGTGTTCTCAGTATTGGAGGGAAGGAG	0.3
α(R)	TGAAGAGCCTGCAGGACCAGGTCAGTGACCG	0.15
MED(F)	CGATGAGAACATAGTGAGCAGAATTGCAGG	0.15
MED(R)	ACGCCGACGTTGCTGCCCAGCTTCTTCCAC	0.15
SEA(R)	ATATATGGGTCTGGAAGTGTATCCCTCCCA	0.15
FIL(F)	AAGAGAATAAACCACCCAATTTTTAAATGGGCA	1.6
FIL(R)	GAGATAATAACCTTTATCTGCCACATGTAGCAA	1.6
α⁺	Multiplex PCR	From JM Old (pers. comm.)
3.7F	CCCCTCGCCAAGTCCACCC	0.4
3.7/20.5R	AAAGCACTCTAGGGTCCAGCG	0.4
4.2F	GGTTTACCCATGTGGTGCCTC	0.6
4.2R	CCCGTTGGATCTTCTCATTTCCC	0.8
α2R	AGACCAGGAAGGGCCGGTG	0.1

PCR, polymerase chain reaction.

Disorders of coagulation

Thrombophilia

Considerable advances have been made in our understanding of the genetic risk factors found in patients with venous thromboembolism (VTE).¹⁷ Among these are the diverse mutations causing protein C, protein S and antithrombin deficiency. An increased factor VIII level is also a risk factor for VTE, but the genetic determinants of this are unclear. Homozygosity for the common C677T mutation of the methylenetetrahydrofolate reductase gene, which gives rise to a thermolabile variant of this protein, has been reported to be a risk factor for VTE, although other studies have not supported this claim. A point mutation in the 3′ UTR of the prothrombin gene associated with elevated protein levels has been identified as a genetic risk factor for VTE.¹⁸ The most common of the known genetic risk factors for VTE is a resistance to the anticoagulant effect of activated protein C caused by the Arg506Gln substitution in factor V (factor V Leiden, FVL);¹⁹ around 20% of subjects of north European origin presenting for the first time with thromboembolism are heterozygous for this mutation. Because of their prevalence and because the tests have become relatively simple, there is a tendency toward indiscriminate testing for these genetic risk factors in thrombophilia, but without careful and informed counselling this may often be inappropriate (see also Chapter 19).²⁰